| __________ |
| News |
| Most Recent |
| • |
| Submit Item |
| • |
| Submission Policy |
________ |
Scholarly Publications Database |
| • |
| Main Index |
________ |
Geographic Database |
| • |
| Main Index |
_______ |
Site Map |
| • |
| About This Site |
Submitter: Roghiye Teyrmourpour
Email: ecolilyme@yahoo.com
Type: Publication
State:
Nation: Iran
Date: --
Evaluation tetanus toxin Fragment C expression in Two hosts/vectors
Roghiye Teyrmourpour , * Khosrow Aghayipour, Majid Esmaelizad
,Sedighe Sadat Safavieh, Ahmadreza Jabbary,Ebrahim Abbasi
Dept. of Biotechnology, Razi Vaccine and Serum Research Institute, Karaj, Iran
ABSTRACT
OBJECTIVE: high level expression of tetanus toxin fragment C (TetC) with good immunogenicity METHODS: The gene fragment encoding TetCwas amplified from Clostridium tetani plasmid DNA by PCR.This 1356bp Fragment C was subcloned into the high-expression vectors pEt-22b(+) and pEt-28-(+) ,under T7promoter and were transferred intoE. coli BL21(DE3)plysS. Over expression of TetC was examined with SDS-PAGE. CONCLUSION and RESULTS: The tetc gene encoding TetC was obtained, and the constructed recombinant expression vector s pET.22b (+)-TTC and pET.28a (+)-TTC were successfully expressed in E. coli BL21(DE3)plysS. SDS-PAGE identified a recombinant fusion protein with relative molecular mass of 54KD and Native form with 51.6KD.Theses proteins can be used for further studies, including purification and neutralizing antibody production against TetC.
Keywords: Fragment C, Clostridium tetani, pET vectors, SDS-PAGE
Introduction
Clostridium tetani is , a mobile, spore-forming, anaerobic, gram-positive bacillus. Under anaerobic conditions, the spores of C. tetani germinate and produce 2 toxins: tetanolysin (a hemolysin with no recognized pathologic activity) and tetanospasmin, which is responsible for tetanus. Tetanospasmin is synthesized as a single 151-kd chain and is cleaved to generate toxins with 2 chains joined by a single disulfide bond. The heavy chain (100 kd) is responsible for specific binding to neuronal cells and for protein transport. The light chain (50 kd) blocks the release of neurotransmitters.Neonatal tetanus is a major cause of infant mortality in underdeveloped countries and mortality is estimated 400,000 deaths annually., but this form is rare in developed country. Infection results from cord contamination during unsanitary delivery conditions, coupled with a lack of maternal immunization. Tetanus can be prevented by vaccination. Current tetanus vaccines are based on inactivated tetanus toxin and are extremely effective in generating serum anti-toxin antibodies which protect against the highly potent neurotoxin released upon infection by Clostridium tetaniHowever, three doses of an injectable vaccine are necessary, which is far from ideal in many developing countries where the logistics of storage, delivery, and compliance are complex. Consequently, there are an estimated 250,000 cases of tetanus per year, the majority of which are neonatal tetanus.A novel vaccine bace on FragmentC that could be given by the oral, intranasal, or transdermal route could potentially reduce the burden of neonatal tetanus as well as provide a convenient booster for the adult population. HC is antigenically active,atoxic can induce protective antibodies when given by a variety of delivery systems and routes, e.g., parenterally (19), orally using an attenuated Salmonella delivery system (9), as a plant vaccine (30), or as a DNA vaccine (1). To this end, HC has been proposed as a possible replacement for the existing tetanus toxoid vaccine.Here we describe Fragment C and Fragment C-thrombine-gene fosion expression in E. coli BL21(DE3)plysS obtained by using the pEt-22b(+) and pEt-28-(+ ) respectively.
*Corresponding Author; Tel. (+98-0261)4552005-8; Khosrow@rvsri.com
MATERIALS AND METHODS
Bacterial strains and plasmids: Harvard strain of Clostridium tetani obtained from DTP department , Razi institute . Modified Mueller’s Media was used for culture of clostridium seeds.For initial cloning ,sequencing and maintenance of the DNA fragments, used pTZ57R and Ecoli srains DH5α (Fermentase), for protein production, expression vector pET28a (+) and pET22b(+) (Novagen) and bacterial strain BL21 (DE3) pLysS were used. Bacterial transformation and DNA manipulations were performed as described by Sambrook et al.
Extraction of Total DNA
After period incubation, grown bacteria harvest from Modified Mueller’s Media with centrifuge. Pellet bacteria was used to extract whole DNA(cells and plasmide). DNA was extracted and purified by Kit(Roche Diagnostic).
Primers design
Primers were designed by Oligo software. The forward primer,( 5\' GGA ATT CCA TAT GAA AAA TCT GGA TTG TTG GGT3\') contains Nde1site. Reverse primers (5\' CCG CTC GAG CTA ATC ATT TGT CCA TCC TT 3\') / (5\' CCC AAG CTT CTA ATC ATT TGT CCA TCC TT 3\' ) contain recognition site for XhoI or HindIII respectively and stop codon.
Enzymes
Restriction enzymes(Nde1, XhoI , HindIII),DNA polymerase (pfu, Taq) were purchased from New England BioLabs and Fermentas Life Science.
Polymerase Chain Reaction
PCR was performed in a 50 μl total volume containing 300ng of template DNA, 10 pmol/reaction of each primer, 1.5 mM MgCL2, 0.2Mm dNTP (Roche Diagnostics, Germany), 1´ PCR buffer and 1unit of pfu combied with 0.5unit of Taq DNA polymerase (Fermentas). The following conditions were used for amplification: hot start at 95˚C for five minutes, followed by 35 cycles of denaturation at 95˚C for one minute, annealing at The first five cycles50˚C for one minute and others57˚C , extension at 72˚C for one minute . The program followed by a final extension at 72˚C for ten minutes. The PCR product was analyzed by electrophoresis in 1% agarose gel in 1´ TBE buffer and visualized by ethidium bromide staining on UV transilluminator. The PCR product was purified from the agarose gel by high pure PCR product purification kit (Roche Diagnostic, Germany) according to the manufacturer recommendation. The purity of eluted PCR product was checked by electrophoresis in 1% agarose gel in 1 ´ TBE buffer. DNA sequencing was performed by the dideoxy chain termination technique of Sanger et al.
Cloning of Fragment C
For subcloning in different multicloning site (MCS) was used two pairs primer a part , with restriction sites NdeІ/ Hind ІІІ and NdeІ/ Xho1for amplification of fragment C by hot start PCR. Fragment C gene with 3\'-dA overhangs that generated by Taq DNA polymerase was cloned in cloning vector pTZ57R/T with 3\'-dT overhangs at both ends by T4 ligase and transformed into E. coli strain DH5α Tvectore contains fragment C was isolated by IPTG conjunction with X-Gal to determine the lac phenotype in blue/white colony screening. The suspected colony was further analyzed by restriction enzyme digestion and PCR. M13/pUC 5\'-d(GTAAAACGACGGCCAGT)-3\' and T7 promoter 5\'- d(TAATACGACTCACTATAGGG)-3 \' primers were used for sequencing (MWG,Germany).
Expression
In order to subcloning, T vectores were digested with NdeІ, Hind ІІІ or Xho1 enzymes. The digested product(around 1400bp) Kb was purified and ligated into the pET22b(+) and pET28a(+) vectors(Novagen) by T4 ligase as described in pET Manual system. E.coli strain BL21 (DE3) pLysS transformed with pET28a(+) -fragment C and pET22b(+)-fragment C were cultured in LB supplemented with glucose 1% ,chloramphenicol 34μg/ml,kanamycine 30μg/ml and ampicillin50μg/ml at 37,33,30,25° C with good aeration to early exponential phase (OD 600 approximately 0.6). Plasmids containing toxic genes may be destabilized in DE3 lysogens due to cAMP stimulation of T7 RNA polymeras that can be eliminated by adding 0.5-1 % glucose in the culture medium.IPTG was added to final concentration of 1mM for inducrtion and the cultures were grown with shaking for an additional 3h.The cells were harvested by centrifugation . loading buffer (OD /10) was added to pellet bacteia and then Cells was heated 100˚/3′ to denaturate as described in Sambrook et.al. SDS-PAGE(12.5 % ) was used for visualization of the expressed protein and the protein bands were stained with Coomassie Blue.
RESULTS
DNA preparation and amplification
Because tetc is located on a large plasmide (74kb),the Total DNA(cells and plasmids) of Clostridium tetani was prepared and the concentration was adjusted to300ng/ml, which was used as template for amplification of the gene encoded 1356 bp tetanus toxin fragment C. The amplified fragment had the expected size of 1356 bp comparing to1000 bp DNA ladder (Fermentas).to increase specificity of PCR two strategy was used including combination pfu DNA polymerase(3′→5′ exonuclease activity ) with Taq DNA polymerase and employment Hot Start PCR for DNA amplification to restrain ‘mis-priming’ and ‘primer dimer’ extension products (Fig. 1).
Figure 1. PCR product of Clostridium tetani Lane 2,3(1356 bp):
1kb marker(fermentase); lanes 1.
Figure 2. Lane 1,marker
Lane2, Digestion products of pET22b with NdeІ and Xho1
Lane3, Digestion products of pTZ57R with NdeІ
Lane 4, Digestion products of pTZ57R with NdeІ and Xho1
Figure 3. Lane 1,marker
Lane2, Digestion products of pTZ57R with NdeІ
Lane 3, Digestion products of pTZ57R with HindIII andNde1
Lane4, Digestion products of pET28a with HindIII andNde1
Molecular analysis of Fragment C
Two high level expression vectors under the control of T7promoter were selected . The plasmid pET-22b-tetc ecoding for native fragment C was resulted from subcloning of tetc gene in expression vector (pET-22b). Plasmid pET-28a-tetc was obtained after the subcloning of tetcin expression vectors (pET-28a). The constructed plasmids expressed the tetC in native (452 amino acids) or fusion forms (His.Tag and thrombine) in E. coli (475amino acids). Competent E. coli BL21 (DE3) pLysS cells were transformed with pET28a and pET22b expression vector harboring pET-tetC plasmid . Expression of pET28a-tetc and pET-22b-tetc in E. coli BL21 (DE3) pLysS was induced and the produced protein (Fig.). SDS-PAGE analyses showed the expected molecular mass of near 54 kDa fusion recombinant protein and 51.6kDa native protein.
Figure 4. SDS-PAGE analysis of total cell lysate of E. coli BL21
DE3 (pLysS) containing pET22b and pET28a showing the expression of Fragment C
Lane 3, protein marker. Lanes 2,4,5,6, cell lysate of E. coli BL21 DE3(pLysS) containing
pET22b after induction with IPTG. Lanes 7-10, cell lysate of E. coli BL21 DE3(pLysS) containing
pET28a after induction with IPTG. Lane 2,7, before induction with
IPTG.Lane 1,control.
DISCUSSION
Papain digest of the tetanus toxin yields two fragments: B and C .fragment B is still toxic whereas fragment C is atoxic[11]. there is many report about the antigenicity or immunogenicity of fragment C in human and has been identified as an immunodominant antigen of tetanus toxin.Fragment C has been expressed alone or in fusion with nother antigens in different strains of salmonella,BCG,Bordetella and etc inducing protective antibodies against tetanus toxin[1,2,3,5,4].
To production recombinant fragment C, two strains of Ecoli as expression host was examined , E. coli BL21 DE3 and pLysS .These strain are deficient in the Lon protease and lack the ompT outer membrane protease that can degrade proteins thus target protein should be more stable in these strain than in host starin containing these protease . pLysS strain in compare with DE3 solely has plysS plasmid that carry chloramphenicol resistant gene. The presence of plysS increase the tolerance of λDE3 lysogens for plasmids with toxic inserts: unstable plasmids become stable , and plasmids that would not otherwise be established can be maintained and expressed[pET manual system]. Any expression in inductive condition (1mM IPTG at 37,33,30,25° C)by DE3 strain not seen similarly by plysS strain at 37° C and 33° C temperatures. At 30 ° C E. coli BL21 (DE3) pLysS transformd with pET-22b and pET-28a showed low protein production.Optimal express condition was acquired ,for two vectors ,at 25° C and 1mM IPTG.growth at 25° Ccauses reduse expression protein of own Ecoli and allowed foriegnantigen can to be expressed.
Tansformed E. coli BL21 (DE3) pLysS with pET-28a produced a fusion protein (≈54kD)consisting of His.tag (6amino acide )and thrombine ( 6amino acide) in N-terminal proportion as well as cells transeformed with pET-22b produced protein(≈51.6) in native form that were analysised by SDS-PAGE.His.Tag can facilitate detection of recombinant protein on western blots and purification by using resin and buffer kits. His.Tag also increase probality of biological activity by affecting solubility in the cytoplasm[25].
By using pET expression system we produced recombinant fragment C of tetanus toxin in a high yield against other expression systems that produce in low yield. Production of recombinant fragment C in this way can be used for further study such as purification and immunogenicity assay in animal model.
REFERENCES
1. Goonetilleke A, Harris JB.(2004) Clostridial neurotoxins. J Neurol Neurosurg Psychiatry.
2. www.who.net/vaccines-diseases
3. Mazzantini RP, Miyaji EN et al.(2004) Adjuvant activity of Mycobacterium bovis BCG expressing CRM197 on the immune response induced by BCG expressing tetanus toxin fragment C. VaccineJan 26;22(5-6):740-6.
4. Pamela M. Norton, Henry W.G. et al. (1996) Factors affecting the immunogenicity of tetanus toxin fragment C expressed in Lactococcus lactis. FEMS Immunology Medical Microbiology Vol. 14 Issue 2-3 Page 167 June
5. RAYMOND J. JACKSON et al (1994) Oral Vaccine Models: Multiple Delivery Systems Employing Tetanus Toxoid. Annals of the New York Academy of Sciences , Vol. 730 Page 217 Microbial Pathogenesis and Immune Response
6. Reveneau N,Alonso S, et al.(2001). Tetanus toxin fragment C-specific priming by intranasal infection with recombinant Bordetella pertussis. Vaccine. 12;20(5-6):926-33
7. Orr N, Galen JE, Levine MM.(2001) Novel use of anaerobically induced promoter, dmsA, for controlled expression of fragment C of tetanus toxin in live attenuated Salmonella enterica serovar Typhi strain CVD 908-htrA. Vaccine. 8;19(13-14):1694-700.
8. Marvaud JC, Raffestin S, et al. (2000) Regulation of the toxinogenesis in Clostridium botulinum and Clostridium tetani. Biol Cell.;92(6):455-7.
9. Medaglini D, Ciabattini et al. (2001) Immunization with recombinant Streptococcus gordonii expressing tetanus toxin fragment C confers protection from lethal challenge in mice. Vaccine. 28;19(15-16):1931-9.
10. Stevenson A, Roberts M.(2004) Intranasal immunisation against tetanus with an attenuated Bordetella bronchiseptica vector expressing FrgC: improved immunogenicity using a Bvg-regulated promoter to express FrgC. Vaccine. 22;22(31-32):4300-5.
11. Helting TB, Nau HH. (1984) Analysis of the immune response to papain digestion products of tetanus toxin. Acta Pathol Microbiol Immunol Scand [C]. 92(1):59-63.
12. RICHARD ANDERSON,1 XIAO-MING GAO,et al.( 1996) Immune Response in Mice following Immunization with DNA Encoding Fragment C of Tetanus ToxinINFECTION AND IMMUNITY p. 3168–3173
13. Bru¨ ggemann, Holger .(2005) Genomics of clostridial pathogens: implication of extrachromosomal elements in pathogenicity. Current Opinion in Microbiology 8:601–605
14. JEAN-CHRISTOPHE MARVAUD,et al.(1998) TetR Is a Positive Regulator of the Tetanus Toxin Gene in Clostridium tetani and Is Homologous to BotR INFECTION AND IMMUNITY, p. 5698–5702
15. J J Farrar, L M Yen, T Cook, N Fairweather, N Binh, J Parry and C M Parry.(2000) DISEASE: Tetanus NEUROLOGICAL ASPECTS OF TROPICAL. J. Neurol. Neurosurg. Psychiatry;292-301
16. Bruggemann H, Gottschalk G. (2004) Insights in metabolism and toxin production from the complete genome sequence of Clostridium tetani. Anaerobe. 10(2):53-68
17. Stevenson A, Roberts M.(2004) Intranasal immunisation against tetanus with an attenuated Bordetella bronchiseptica vector expressing FrgC: improved immunogenicity using a Bvg-regulated promoter to express FrgC. Vaccine. 22;22(31-32):4300-5
18. Li Y, Aoki R, Dolly JO. (1999) Expression and characterisation of the heavy chain of tetanus toxin: reconstitution of the fully-recombinant dichain protein in active form. J Biochem (Tokyo). 125(6):1200-8.
19. Raffestin S, Dupuy B, Marvaud JC, Popoff MR. (2005) BotR/A and TetR are alternative RNA polymerase sigma factors controlling the expression of the neurotoxin and associated protein genes in Clostridium botulinum type A and Clostridium tetani. Mol Microbiol. 55(1):235-49.
20. Ribas AV, Ho PL, Tanizaki MM, Raw I, Nascimento AL. (2000) High-level expression of tetanus toxin fragment C-thioredoxin fusion protein in Escherichia coli. Biotechnol Appl Biochem. 31 ( Pt 2):91-4.
21. Reveneau N, Alonso S, Jacob-Dubuisson F, Mercenier A, Locht C. (2001) Tetanus toxin fragment C-specific priming by intranasal infection with recombinant Bordetella pertussis. Vaccine. 20(5-6):926-33.
22. Medaglini D, et al.(2001) Immunization with recombinant Streptococcus gordonii expressing tetanus toxin fragment C confers protection from lethal challenge in mice. Vaccine. 19(15-16):1931-9.
23. Grangette C,et al.(2002) Protection against tetanus toxin after intragastric administration of two recombinant lactic acid bacteria: impact of strain viability and in vivo persistence. Vaccine. 20(27-28):3304-9.
24. Carlton E, Teng Q, Federici T, Yang J, Riley J, Boulis NM.( 2008) Fusion of the tetanus toxin C fragment binding domain and Bcl-xL for protection of peripheral nerve neurons. Neurosurgery. 63(6):1175-82
25. pET system manual(Novagen)10th edition(2002)